Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311423

Morpholino Name: cep295 or kiaa1731 MO1
Synonyms: TEgg061a13, Xtnovel49
Target mRNA: cep295

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTTTGCGTTTCATCTTCACATTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTAATGTGAAGATGAAACGCAAAGT 3' ||||||||||||||||||||||||| 3' GATTACACTTCTACTTTGCGTTTCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:24179817..24179841 21/25 Sense off-target rassf7.L
chr5S:35149724..35149748 21/25 Antisense off-target vta1.S
chr5S:98707844..98707868 21/25 unknown
chr9_10L:94209745..94209769 21/25 unknown
tropicalis 10.0 Chr2:165769837..165769861 25/25 Antisense target cep295
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers