Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311424

Morpholino Name: cep295 or kiaa1731 MO2
Synonyms: TEgg061a13, Xtnovel49.2
Target mRNA: cep295

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTATAGGCTGTGCTGAAGTGAAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:39301846..39301870 22/25 Sense off-target LOC108702166 [provisional:rgs9]
chr1L:180221687..180221711 21/25 Sense off-target LOC108717391 [provisional:fam172a]
chr4S:64310886..64310910 21/25 Sense off-target gpbp1l1.S
chr1S:79041538..79041562 21/25 unknown
chr3L:143771453..143771477 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers