Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311425

Morpholino Name: c1orf131 MO1
Synonyms: TGas141c24, Xtnovel5
Target mRNA: c1orf131

Morpholino Type: uncategorized morpholino
Sequence: 5' GATCTCGTTCTGCCATATTAGAGCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' CGCTCTAATATGGCAGAACGAGATC 3' ||||||||||||||||||||||||| 3' GCGAGATTATACCGTCTTGCTCTAG 5' 5' CTTTCTAATATGGCTGAACGAGATC 3' | ||||||||||| |||||||||| 3' GCGAGATTATACCGTCTTGCTCTAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:49913556..49913580 22/25 Antisense target c1orf131.L
chr3L:106013650..106013674 21/25 Sense off-target synm.L
tropicalis 10.0 Chr5:50202434..50202458 25/25 Antisense target c1orf131
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers