Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311427

Morpholino Name: ncaph2 MO2
Synonyms: TEgg019e13, Xtnovel50.2
Target mRNA: ncaph2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTTCTTTACTGAAGGTATGTGCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' AGGCACATACCTTCAGTAAAGTGAG 3' ||||||||||||||||||||| | 3' TCCGTGTATGGAAGTCATTTCTTTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:13366278..13366302 21/25 Antisense off-target sgcd.L
chr7S:23470881..23470905 21/25 Sense off-target LOC108697453 [provisional:plce1]
chr1L:197398300..197398324 21/25 unknown
chr4S:17152168..17152192 21/25 unknown
chr8S:3998659..3998683 21/25 unknown
tropicalis 10.0 Chr3:89408285..89408309 22/25 Antisense target ncaph2
Chr3:89408285..89408309 22/25 Sense off-target lmf2
Chr10:44037974..44037998 21/25 Sense off-target tmem104
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers