Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311428

Morpholino Name: rcbtb2 MO1
Synonyms: TEgg066c16, Xtnovel52
Target mRNA: rcbtb2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCATTTTCCAACATCCACCATTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' ACAATGGTGGATGTTGGAAAATGGC 3' ||||||||||||||||||||||||| 3' TGTTACCACCTACAACCTTTTACCG 5' 5' AAAATGGTGGATGTTGGAAAATGGC 3' | ||||||||||||||||||||||| 3' TGTTACCACCTACAACCTTTTACCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:117535691..117535715 24/25 Antisense target rcbtb2.S
chr1S:167499214..167499238 22/25 Sense off-target prlr.S
chr1L:28078026..28078050 21/25 Antisense off-target rfc1.L
chr1S:117855056..117855080 21/25 Sense off-target LOC108707058
chr1S:117855056..117855080 21/25 Sense off-target LOC108705035 [provisional:mtmr3]
chr2S:131835970..131835994 21/25 Antisense off-target cab39l.S
chr2S:132024162..132024186 21/25 Antisense off-target rcbtb1.S
chr3S:21546114..21546138 21/25 Sense off-target fgfr1.S
chr7L:106492802..106492826 21/25 Sense off-target fuz.L
chr9_10L:70325109..70325133 22/25 unknown
chr3L:61368430..61368454 21/25 unknown
chr3S:80468174..80468198 21/25 unknown
tropicalis 10.0 Chr2:135053721..135053745 25/25 Antisense target rcbtb2
Chr4:19071892..19071916 21/25 Antisense off-target pax6
Chr4:60334162..60334186 21/25 Sense off-target LOC105947251
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers