Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311430

Morpholino Name: eogt MO1
Synonyms: TEgg142j04
Target mRNA: eogt

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGCAACGGGTCCTATCTTTAAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATTTCAGATAGGACCCGTTGCCATG 3' ||| |||||||||||||||||||| 3' TAATTTCTATCCTGGGCAACGGTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:37209757..37209781 22/25 unknown
tropicalis 10.0 Chr4:142059437..142059461 23/25 Antisense target eogt
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers