Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311433

Morpholino Name: zup1 MO1
Synonyms: TNeu109g23, Xtnovel57, zufsp MO1
Target mRNA: zup1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTGCAGATGTCACAAATAAGCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' CATGCTCATTTGTGACATCTGCACT 3' |||||| |||||||||||||||||| 3' GTACGAATAAACACTGTAGACGTGA 5' 5' CATGTTTATTTGTGACATCTGCACT 3' |||| |||||||||||||||||||| 3' GTACGAATAAACACTGTAGACGTGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5S:57108191..57108215 24/25 Antisense target zup1.S
chr5L:77797597..77797621 21/25 Antisense off-target lama4.L
chr5S:126421642..126421666 21/25 Antisense off-target fkbp1b.S
chr8S:91287126..91287150 21/25 unknown
tropicalis 10.0 Chr5:74825853..74825877 24/25 Antisense target zup1
Chr2:135380222..135380246 21/25 unknown
Chr4:79245701..79245725 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers