Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311434

Morpholino Name: tceanc2 MO1
Synonyms: TEgg006f18, Xtnovel58
Target mRNA: tceanc2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTCCTGATTACAAATCTGTCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GATGGACAGATTTGTAATCAGGAAG 3' ||||||||||||||||||||||||| 3' CTACCTGTCTAAACATTAGTCCTTC 5' 5' GATGGACAAATTTGTAATCAGGAAG 3' |||||||| |||||||||||||||| 3' CTACCTGTCTAAACATTAGTCCTTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:71081745..71081769 24/25 Antisense target tceanc2.S
chr4S:71081745..71081769 24/25 Sense off-target tmem59.S
chr2S:61970494..61970518 21/25 Antisense off-target LOC108709508 [provisional:morc1]
chr6L:124568932..124568956 21/25 Sense off-target zfand1.L
chr6S:1321832..1321856 21/25 Antisense off-target LOC108695557
chr4L:87517559..87517583 22/25 unknown
chr2L:167947055..167947079 21/25 unknown
chr6L:105893112..105893136 21/25 unknown
chr6S:59184151..59184175 21/25 unknown
chr9_10S:69746373..69746397 21/25 unknown
tropicalis 10.0 Chr4:97427486..97427510 25/25 Antisense target tceanc2
Chr4:97427486..97427510 25/25 Sense off-target tmem59
Chr8:49399589..49399613 22/25 Antisense off-target tenm1
Chr8:49399589..49399613 22/25 Sense off-target LOC101731292
Chr1:45392585..45392609 21/25 Sense off-target wwc2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers