Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311435

Morpholino Name: wdr74 MO1
Synonyms: TGas076f10, Xtnovel6
Target mRNA: wdr74

Morpholino Type: uncategorized morpholino
Sequence: 5' CGTGATTCCGAGCAGGCGCTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGGCAGCGCCTGCTCGGAATCACG 3' ||||||||||||||||||||||||| 3' TACCGTCGCGGACGAGCCTTAGTGC 5' 5' ATGGCAGCGCCCGTTCGGAATCACG 3' ||||||||||| | ||||||||||| 3' TACCGTCGCGGACGAGCCTTAGTGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:26121475..26121499 23/25 Antisense target wdr74.L
tropicalis 10.0 Chr4:36477284..36477308 25/25 Antisense target wdr74
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers