Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311438

Morpholino Name: calhm2 MO2
Synonyms: TGas083e14, Xtnovel8.2
Target mRNA: calhm2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTAGCAGTCAGATGATGAAGGAACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGTTCCTTCATCATCTGACTGCTAA 3' ||||||||||||||||||||||||| 3' CCAAGGAAGTAGTAGACTGACGATT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:106265972..106265996 22/25 Antisense off-target LOC108719746 [provisional:vps13b]
chr5S:82691279..82691303 21/25 Antisense off-target b3gnt7.S
tropicalis 10.0 Chr7:28544988..28545012 25/25 Antisense target calhm2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers