Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311439

Morpholino Name: nsrp1 MO1
Synonyms: TGas009o23, Xtnovel9
Target mRNA: nsrp1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCAAAATAAGCCCATACATTCCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:170669159..170669183 22/25 Sense off-target cep120.L
chr7S:47414746..47414770 21/25 Antisense off-target fli1.S
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers