Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311440

Morpholino Name: mga MO1
Synonyms: TEgg085b11, Xtnoveltbox
Target mRNA: mga

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTTTCTCCATGATTGTTAATTTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' CAAATTAACAATCATGGAGAAACC 3' |||||||||||||||||||||||| 3' GTTTAATTGTTAGTACCTCTTTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:8690201..8690224 20/24 Sense off-target ntf3.S
chr6L:133034033..133034056 20/24 Sense off-target baalc.L
chr4L:47039993..47040016 21/24 unknown
tropicalis 10.0 Chr8:105175417..105175440 24/24 Antisense target mga
Chr2:109922050..109922073 21/24 Antisense off-target tmtops2
Chr3:82824567..82824590 20/24 Sense off-target celf2
Chr8:120312840..120312863 21/24 unknown
Chr4:56741646..56741669 20/24 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers