Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311441

Morpholino Name: mga MO2
Synonyms: TEgg085b11, Xtnoveltbox.2
Target mRNA: mga

Morpholino Type: uncategorized morpholino
Sequence: 5' GATGGATTCTGCAACTCAAAATAAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATTATTTTGAGTTGCAGAATCCATC 3' ||||||||||||||||||||||||| 3' TAATAAAACTCAACGTCTTAGGTAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:48166895..48166919 22/25 Sense off-target gabpb1.S
chr1L:201132661..201132685 21/25 Antisense off-target rictor.L
chr1L:201132661..201132685 21/25 Antisense off-target LOC108718406 [provisional:rictor]
chr1S:173582941..173582965 21/25 Sense off-target ctif.S
chr3L:40101210..40101234 21/25 Sense off-target tspan17.L
chr4L:38325648..38325672 21/25 Sense off-target mbtps1.L
chr9_10S:50917124..50917148 21/25 Sense off-target LOC108702260 [provisional:arhgap15]
Scaffold55:775486..775510 21/25 unknown
chr4L:118868462..118868486 21/25 unknown
chr4S:97989884..97989908 21/25 unknown
tropicalis 10.0 Chr8:105175443..105175467 25/25 Antisense target mga
Chr3:104971032..104971056 22/25 Sense off-target gabpb1
Chr7:50958893..50958917 22/25 Antisense off-target sh2d4b
Chr2:83281081..83281105 21/25 Sense off-target ptpru
Chr5:134570059..134570083 21/25 Sense off-target myt1l
Chr2:125129038..125129062 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers