Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311442

Morpholino Name: pdss2 MO1
Synonyms: TEgg098o12, XtnovelTS
Target mRNA: pdss2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGCACTGGCAAATCAAAGCCATTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' CAATGGCTTTGATTTGCCAGTGCCT 3' ||||||||||||||||||||||||| 3' GTTACCGAAACTAAACGGTCACGGA 5' 5' CAATGTCTTTGATTTGCCAGTGTCT 3' ||||| |||||||||||||||| || 3' GTTACCGAAACTAAACGGTCACGGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5S:61390457..61390481 23/25 Antisense target pdss2.S
chr1L:40724742..40724766 21/25 Sense off-target neil3.L
chr3L:18091108..18091132 21/25 Antisense off-target gabra1.L
chr5L:31383052..31383076 21/25 Antisense off-target b3gnt2.L
Scaffold20:3275831..3275855 22/25 unknown
Scaffold45:806598..806622 22/25 unknown
tropicalis 10.0 Chr5:78874806..78874830 25/25 Antisense target pdss2
Chr2:29282565..29282589 21/25 Sense off-target glra2
Chr4:138551533..138551557 21/25 Sense off-target camk1
Chr3:55937471..55937495 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers