Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311446

Morpholino Name: nodal3.1 MO2
Synonyms: TGas097d22, Xtnr3
Target mRNA: nodal3.1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGGGTAGATTCTTGGTGACTCCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAGGAGTCACCAAGAATCTACCCAG 3' ||||||||||||||||||||||||| 3' GTCCTCAGTGGTTCTTAGATGGGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1S:104353263..104353287 21/25 Sense off-target kank1.S
chr5L:35318128..35318152 21/25 Sense off-target bcl2l11.L
tropicalis 10.0 Chr3:132081117..132081141 25/25 Antisense target nodal3.1
Chr3:132086862..132086886 25/25 Antisense off-target LOC100491713
Chr3:132091565..132091589 25/25 Antisense off-target LOC100488935
Chr3:132095260..132095284 25/25 Antisense off-target LOC101732995
Chr3:132100177..132100201 25/25 Antisense off-target LOC101732995
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers