Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311448

Morpholino Name: loc100144286 MO1
Synonyms: OA1, TGas030h04, XtOA1
Target mRNA: XB5730431 [provisional]

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCTGGGCAAGTGCACTGATGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:21968724..21968748 24/25 Antisense off-target XB5730431.L
chr6L:105002254..105002278 21/25 Sense off-target LOC108719201 [provisional:ptprm]
chr7L:10564875..10564899 21/25 Sense off-target bicc1.L
chr8S:32807266..32807290 21/25 Sense off-target LOC108699944
chr9_10L:57941089..57941113 21/25 Antisense off-target tnfaip6.L
chr3S:36917115..36917139 21/25 unknown
chr4L:52768643..52768667 21/25 unknown
tropicalis 10.0 Chr8:44397892..44397916 25/25 Antisense off-target LOC100144286
Chr1:125724114..125724138 22/25 Sense off-target ptprd
Chr1:195984571..195984595 21/25 Sense off-target ttc33
Chr4:74848446..74848470 21/25 Sense off-target pdpr
Chr6:100566619..100566643 21/25 Sense off-target neto1
Chr8:80775978..80776002 21/25 Sense off-target LOC100144987
Chr1:200052229..200052253 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers