Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311450

Morpholino Name: ing2 MO1
Synonyms: TGas136i03, Xtp32INGL, p32INGL
Target mRNA: ing2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTGTTGCTGTTGTTGCCCTAACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGTTAGGGCAACAACAGCAACACT 3' ||||||||||||||||||||||||| 3' TACAATCCCGTTGTTGTCGTTGTGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:49889507..49889531 21/25 unknown
chr4S:551551..551575 21/25 unknown
tropicalis 10.0 Chr1:45198128..45198152 25/25 Antisense target ing2
Chr8:63782524..63782548 21/25 Antisense off-target LOC101733301
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers