Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311451

Morpholino Name: tp53 MO4
Synonyms: TNeu034a23, Xtp53, p53
Target mRNA: tp53

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCGGTCTCAGAAGAAGGTTCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATGGAACCTTCTTCTGAGACCGGC 3' ||||||||||||||||||||||||| 3' GTACCTTGGAAGAAGACTCTGGCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold190:8849..8873 22/25 Antisense off-target LOC108705589 [provisional:tp53]
Scaffold30335:470..494 23/25 unknown
Scaffold58326:175..199 23/25 unknown
tropicalis 10.0 Chr3:153636047..153636071 25/25 Antisense target tp53
Chr3:153636047..153636071 25/25 Antisense off-target LOC116409659
Chr1:87544704..87544728 21/25 Antisense off-target aff1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers