Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311453

Morpholino Name: mark2 MO4
Synonyms: Xtpar1, par1
Target mRNA: mark2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTTGCTGCTATATCCTCCAACATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' GATGTTGGAGGATATAGCAGCAAAG 3' ||||||||||||||||||||||||| 3' CTACAACCTCCTATATCGTCGTTTC 5' 5' GATGTTGGAGGATTTAGCAGCAAAG 3' ||||||||||||| ||||||||||| 3' CTACAACCTCCTATATCGTCGTTTC 5' 5' CATGTTGGAGGATTTAGCAGCAAAG 3' |||||||||||| ||||||||||| 3' CTACAACCTCCTATATCGTCGTTTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:25804462..25804486 24/25 Antisense target mark2.L
chr4S:1856309..1856333 23/25 Antisense target mark2.S
Scaffold44:34366..34390 21/25 Sense off-target psmd1.L
chr1L:137387212..137387236 21/25 Antisense off-target cdc42se2l.L
chr1S:13385073..13385097 21/25 Antisense off-target LOC108706522 [provisional:vim]
chr1S:171101914..171101938 22/25 unknown
tropicalis 10.0 Chr4:36203590..36203614 25/25 Antisense target mark2
Chr2:56691410..56691434 21/25 Sense off-target ddx3x
Chr6:61006955..61006979 21/25 Antisense off-target golga4
Chr1:55575218..55575242 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers