Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311454

Morpholino Name: pard3b MO1
Synonyms: Par3B, TEgg004p11, XtPar3
Target mRNA: pard3b

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCCAAAGCAAACGGTTACTTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGAAAGTAACCGTTTGCTTTGGGA 3' ||||||||||||||||||||||||| 3' TACTTTCATTGGCAAACGAAACCCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:72518629..72518653 25/25 Antisense off-target LOC108703061 [provisional:pard3b]
chr9_10L:79869115..79869139 24/25 Antisense off-target pard3b-like.L
Scaffold24:252252..252276 21/25 Sense off-target il17rd.L
chr3L:102606050..102606074 21/25 Antisense off-target slco3a1.L
chr4L:39187571..39187595 21/25 Antisense off-target rbl2.L
chr4S:54932156..54932180 21/25 Antisense off-target Xelaev18025069m
chr1L:89793207..89793231 21/25 unknown
tropicalis 10.0 Chr9:51661545..51661569 25/25 Antisense target pard3b
Chr2:101548058..101548082 21/25 Sense off-target atp2a3
Chr2:121118353..121118377 21/25 Antisense off-target ubac2
Chr2:164355329..164355353 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers