Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311455

Morpholino Name: pard6g MO1
Synonyms: PAR6A, TNeu123j18, XtPar6A
Target mRNA: pard6g

Morpholino Type: uncategorized morpholino
Sequence: 5' GGACTTACTGAAGCTGCGGTTCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' GATGAACCGCAGCTTCAGTAAGTCC 3' ||||||||||||||||||||||||| 3' CTACTTGGCGTCGAAGTCATTCAGG 5' 5' GATGAACCGCAGCTTTAGTAAGTCC 3' ||||||||||||||| ||||||||| 3' CTACTTGGCGTCGAAGTCATTCAGG 5' 5' GATGAACCGCAGCTTTAGTAAGTCC 3' ||||||||||||||| ||||||||| 3' CTACTTGGCGTCGAAGTCATTCAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:95632563..95632587 24/25 Antisense target pard6g.L
chr6S:74771851..74771875 24/25 Antisense target pard6g.S
chr3L:71732377..71732401 22/25 Sense off-target elapor2.L
tropicalis 10.0 Chr6:96308645..96308669 25/25 Antisense target pard6g
Chr6:147748892..147748916 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers