Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311456

Morpholino Name: pard6b MO2
Synonyms: PAR6B, TNeu127e06, XtPar6B
Target mRNA: pard6b

Morpholino Type: uncategorized morpholino
Sequence: 5' GTGCCCCCGGTTCATGTTGCCAGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CACTGGCAACATGAACCGGGGGCAC 3' ||||||||||||||||||||||||| 3' GTGACCGTTGTACTTGGCCCCCGTG 5' 5' CACTGGCAACATGAACCGGGGACAC 3' ||||||||||||||||||||| ||| 3' GTGACCGTTGTACTTGGCCCCCGTG 5' 5' CACTGGCAACATGAACCGGGGACAC 3' ||||||||||||||||||||| ||| 3' GTGACCGTTGTACTTGGCCCCCGTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:10950437..10950461 24/25 Antisense target pard6b.L
chr9_10S:9865727..9865751 24/25 Antisense target pard6b.S
chr7L:1288949..1288973 21/25 unknown
tropicalis 10.0 Chr10:35745920..35745944 25/25 Antisense target pard6b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers