Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311457

Morpholino Name: myo18a MO1
Synonyms: TGas067c02, XtPDZlike
Target mRNA: myo18a

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTCCTTTTTCATCAAGTGGAACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' ATGTTCCACTTGATGAAAAAGGAGA 3' ||||||||||||||||||||||||| 3' TACAAGGTGAACTACTTTTTCCTCT 5' 5' ATGTTCCACTTGAAGAAAAAGGAGA 3' ||||||||||||| ||||||||||| 3' TACAAGGTGAACTACTTTTTCCTCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:31877834..31877858 24/25 Antisense target myo18a.L
chr1L:16671034..16671058 21/25 Antisense off-target afap1.L
chr2S:130102383..130102407 21/25 Sense off-target soat2.S
chr5L:58957264..58957288 21/25 Antisense off-target nid1.L
chr5S:51885255..51885279 21/25 Antisense off-target nid1.S
Scaffold86:565602..565626 22/25 unknown
chr4L:68561937..68561961 21/25 unknown
chr4S:52000669..52000693 21/25 unknown
chr7S:10162569..10162593 21/25 unknown
tropicalis 10.0 Chr2:33151968..33151992 25/25 Antisense target myo18a
Chr2:33151968..33151992 25/25 Sense off-target LOC100038306
Chr2:33151968..33151992 25/25 Antisense off-target LOC100492388
Chr6:15505615..15505639 21/25 Sense off-target dpp6
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers