Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311459

Morpholino Name: rac1 MO2
Synonyms: TEgg073l16, XtRac1
Target mRNA: rac1

Morpholino Type: uncategorized morpholino
Sequence: 5' GACCACACATTTAATGGCCTGCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' CATGCAGGCCATTAAATGTGTGGTC 3' ||||||||||||||||||||||||| 3' GTACGTCCGGTAATTTACACACCAG 5' 5' CATGCAGGCCATTAAATGTGTGGTG 3' |||||||||||||||||||||||| 3' GTACGTCCGGTAATTTACACACCAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:100371223..100371247 24/25 Antisense target rac1.L
chr9_10S:90135662..90135686 24/25 Antisense off-target rac3.S
chr7L:88494623..88494647 22/25 Antisense off-target cdc42.L
chr7S:63470602..63470626 22/25 Antisense off-target cdc42.S
chr4L:115984868..115984892 21/25 Antisense off-target rac2.L
chr4S:95980780..95980804 21/25 Antisense off-target LOC108715797 [provisional:rac2]
chr2L:70861082..70861106 21/25 unknown
tropicalis 10.0 Chr9:25458710..25458734 25/25 Antisense target rac1
Chr4:123075304..123075328 22/25 Antisense off-target rac2
Chr7:94430335..94430359 22/25 Antisense off-target cdc42
Chr10:31667836..31667860 21/25 Antisense off-target rac3
Chr2:47585142..47585166 21/25 Sense off-target sgsm2
Chr1:75376633..75376657 22/25 unknown
Chr10:36841614..36841638 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers