Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311460

Morpholino Name: rad51 MO1
Synonyms: TEgg126n13, XtRad51
Target mRNA: rad51

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCTCTTCTGTGGCTTCTGCTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGAAGCAGAAGCCACAGAAGAGGA 3' ||||||||||||||||||||||||| 3' TACTTCGTCTTCGGTGTCTTCTCCT 5' 5' ATCAAGCAGAAGCCACAGAAGAAGA 3' || ||||||||||||||||||| || 3' TACTTCGTCTTCGGTGTCTTCTCCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:93517844..93517868 23/25 Antisense target rad51.L
Scaffold1499:1390..1414 22/25 Antisense off-target LOC108705825
chr3L:20837429..20837453 22/25 Sense off-target diaph1.L
chr1S:71508518..71508542 21/25 Antisense off-target LOC108706776 [provisional:dnah6]
chr2S:79270450..79270474 21/25 Sense off-target nxn.S
chr7L:96067955..96067979 21/25 Antisense off-target megf6.L
Scaffold41142:376..400 22/25 unknown
chr1S:119315096..119315120 22/25 unknown
chr2S:106008214..106008238 22/25 unknown
chr7S:45035592..45035616 22/25 unknown
Scaffold10133:242..266 21/25 unknown
Scaffold39:146031..146055 21/25 unknown
chr2L:113928241..113928265 21/25 unknown
chr3L:131724029..131724053 21/25 unknown
chr3S:17251428..17251452 21/25 unknown
chr3S:19022051..19022075 21/25 unknown
chr5S:75253067..75253091 21/25 unknown
chr8L:31808688..31808712 21/25 unknown
chr9_10L:78555136..78555160 21/25 unknown
tropicalis 10.0 Chr8:115029380..115029404 25/25 Antisense target rad51
Chr2:171334856..171334880 21/25 Sense off-target dlg2
Chr4:88538538..88538562 21/25 Sense off-target szt2
Chr6:139642011..139642035 21/25 Sense off-target zhx2
Chr6:144596723..144596747 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers