Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311464

Morpholino Name: arid4a MO2
Synonyms: RBBP1, TNeu072l04, XtRBBP1.2
Target mRNA: arid4a

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTTATTTGAGGGATTCCAGCTCGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' TCGAGCTGGAATCCCTCAAATAACC 3' ||||||||||||||||||||||||| 3' AGCTCGACCTTAGGGAGTTTATTGG 5' 5' TCGAGCTGGAATCCCTCAAATAACC 3' ||||||||||||||||||||||||| 3' AGCTCGACCTTAGGGAGTTTATTGG 5' 5' TCGAGCTGGAATCCCTCAAATAACC 3' ||||||||||||||||||||||||| 3' AGCTCGACCTTAGGGAGTTTATTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:80314508..80314532 25/25 Antisense target arid4a.L
chr8S:6924821..6924845 25/25 Antisense target arid4a.S
chr3L:97668732..97668756 22/25 Antisense off-target strc.L
tropicalis 10.0 Chr8:103555695..103555719 25/25 Antisense target arid4a
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers