Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311467

Morpholino Name: serpina3 MO1
Synonyms: Serpina1, TTpA011h07, Xtserpin-related1
Target mRNA: serpina3

Morpholino Type: uncategorized morpholino
Sequence: 5' CAAAATGTAAGGAAGACCCCTCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATGAGGGGTCTTCCTTACATTTTG 3' ||||||||||||||||||||||||| 3' CTACTCCCCAGAAGGAATGTAAAAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1S:2352139..2352163 21/25 Antisense off-target LOC108704042 [provisional:vmn2r26]
chr5L:157429965..157429989 21/25 Sense off-target LOC108717277 [provisional:esco2]
chr1L:203203161..203203185 21/25 unknown
tropicalis 10.0 Chr8:88313298..88313322 25/25 Antisense target serpina3
Chr8:144060232..144060256 21/25 Sense off-target s100a16
Chr8:144060338..144060362 21/25 Sense off-target s100a16
Chr9:27977387..27977411 21/25 Antisense off-target prkar1b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers