Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311469

Morpholino Name: skida1 MO1
Synonyms: Dachshund2-like with gill expression, TGas128i12, Xtski/sno domain
Target mRNA: skida1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTAAAGCCTCCTGCTCCATTAGTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' CCACTAATGGAGCAGGAGGCTTTAA 3' ||||||||||||||||||||||||| 3' GGTGATTACCTCGTCCTCCGAAATT 5' 5' CGCTAAATGGAGCAGGAGGCTTTAA 3' | |||||||||||||||||||| 3' GGTGATTACCTCGTCCTCCGAAATT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:19833031..19833055 21/25 Antisense target skida1.S
chr4S:18030244..18030268 22/25 unknown
tropicalis 10.0 Chr6:27218869..27218893 25/25 Antisense target skida1
Chr6:27218869..27218893 25/25 Antisense off-target Xetrov107041862m.g
Chr3:76722273..76722297 21/25 Sense off-target pik3cg
Chr2:60222333..60222357 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers