Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311471

Morpholino Name: smad4.2 MO3
Synonyms: Smad10, TEgg032k01, XtSmad10
Target mRNA: smad4.2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTCCAGGCTGGCAAACGCCATCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' AGATGGCGTTTGCCAGCCTGGAGCT 3' ||||||||||||||||||||||||| 3' TCTACCGCAAACGGTCGGACCTCGA 5' 5' AGATGGCGTTTGCCAGCCTAGAGCT 3' ||||||||||||||||||| ||||| 3' TCTACCGCAAACGGTCGGACCTCGA 5' 5' AGATGGCGTTTGCCAGCCTAGAGCT 3' ||||||||||||||||||| ||||| 3' TCTACCGCAAACGGTCGGACCTCGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:118047939..118047963 24/25 Antisense target smad4.2.L
chr8S:97554107..97554131 24/25 Antisense target smad4.2.S
chr8S:97554107..97554131 24/25 Antisense target smad4.2.S
chr5S:19588387..19588411 22/25 unknown
tropicalis 10.0 Chr8:144127259..144127283 25/25 Antisense target smad4.2
Chr8:144127259..144127283 25/25 Sense off-target Xetrov107058832m.g
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers