Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311473

Morpholino Name: smad3 MO1
Synonyms: TNeu050m05, Xtsmad3
Target mRNA: smad3

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGGGAAGAATCGAGGACATGACAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genomic

MO
5' CTGTCATGTCCTCGATTCTTCCCTT 3' ||||||||||||||||||||||||| 3' GACAGTACAGGAGCTAAGAAGGGAA 5' 5' CTGCCATGTCCTCGATACTTCCCTT 3' ||| |||||||||||| |||||||| 3' GACAGTACAGGAGCTAAGAAGGGAA 5' 5' CTGTCATGTCCTCGATACTTCCCTT 3' |||||||||||||||| |||||||| 3' GACAGTACAGGAGCTAAGAAGGGAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:35642668..35642692 24/25 Antisense target smad3.S
chr3L:108556321..108556345 23/25 Antisense target smad3.L
chr5L:92255095..92255119 22/25 unknown
chr6L:43985849..43985873 22/25 unknown
chr6S:37715470..37715494 22/25 unknown
chr1S:177968171..177968195 21/25 unknown
chr5S:28706751..28706775 21/25 unknown
tropicalis 10.0 Chr3:117366323..117366347 25/25 Antisense target smad3
Chr3:125617926..125617950 21/25 Antisense off-target ggcx
Chr6:46140161..46140185 22/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers