Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311474

Morpholino Name: smad4.1 MO2
Synonyms: TNeu052c18, XtSmad4, XtSmad4a
Target mRNA: smad4

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTTTGTGATGCACATGGTGTCGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 21/25
genomic

MO
5' GCCGACACCATGTCCATCACAAACA 3' ||||||||||||| ||||||||||| 3' CGGCTGTGGTACACGTAGTGTTTGT 5' 5' ACCGACAATATGTCCATCACAAACA 3' |||||| |||| ||||||||||| 3' CGGCTGTGGTACACGTAGTGTTTGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:209555020..209555044 21/25 Antisense target smad4.1.L
tropicalis 10.0 Chr1:205063175..205063199 24/25 Antisense target smad4.1
Chr8:54020566..54020590 21/25 Antisense off-target diaph2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers