Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311477

Morpholino Name: smad9 MO2
Synonyms: Smad8, TTpA007k16, XtSmad8
Target mRNA: smad9

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTGCTGGCGTGCATAGGATTAGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genomic

MO
5' AGCTAATCCTATGCACGCCAGCACT 3' ||||||||||||||||||||||||| 3' TCGATTAGGATACGTGCGGTCGTGA 5' 5' AGCAAATCCAATGCACGCCAGCACT 3' ||| ||||| ||||||||||||||| 3' TCGATTAGGATACGTGCGGTCGTGA 5' 5' AGCGAATCCTATGCACGCCAGCACT 3' ||| ||||||||||||||||||||| 3' TCGATTAGGATACGTGCGGTCGTGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:134665821..134665845 24/25 Antisense target smad9.S
chr2L:154723949..154723973 23/25 Antisense target smad9.L
chr4L:25172070..25172094 21/25 Sense off-target macrod1.L
chr6L:120381139..120381163 21/25 Antisense off-target LOC108719284 [provisional:arfgef1]
chr9_10L:27895136..27895160 21/25 Sense off-target LOC108701017
Scaffold4015:598..622 21/25 unknown
Scaffold70:202727..202751 21/25 unknown
chr1S:8675153..8675177 21/25 unknown
chr3L:129150885..129150909 21/25 unknown
chr3S:34119515..34119539 21/25 unknown
chr8L:89964815..89964839 21/25 unknown
chr8S:59976857..59976881 21/25 unknown
tropicalis 10.0 Chr2:151740095..151740119 25/25 Antisense target smad9
Chr1:38914183..38914207 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers