Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311478

Morpholino Name: hmg20b MO1
Synonyms: TGas142e24, Xtsmarcelrelated
Target mRNA: hmg20b

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTTTGGTTGGTTGAGACATGATCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' AGATCATGTCTCAACCAACCAAACA 3' ||||||||||||||||||||||||| 3' TCTAGTACAGAGTTGGTTGGTTTGT 5' 5' AGGTCATGTCTCAACCAACTAAACA 3' || |||||||||||||||| ||||| 3' TCTAGTACAGAGTTGGTTGGTTTGT 5' 5' AGATCATGTCTCAACCGACGAAACA 3' |||||||||||||||| || ||||| 3' TCTAGTACAGAGTTGGTTGGTTTGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:89520677..89520701 23/25 Antisense target hmg20b.L
chr1S:78597755..78597779 23/25 Antisense target hmg20b.S
chr5S:8354389..8354413 21/25 Sense off-target daam2.S
chr4L:17958389..17958413 21/25 unknown
chr5L:74640588..74640612 21/25 unknown
tropicalis 10.0 Chr1:93573701..93573725 25/25 Antisense target hmg20b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers