Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311479

Morpholino Name: st13 MO1
Synonyms: TEgg110h11, XtST13
Target mRNA: st13

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGGGTCCATAATGAAGGAGAAATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25 21/25
genomic

MO
5' CATTTCTCCTTCATTATGGACCCGC 3' ||||||||||||||||||||||||| 3' GTAAAGAGGAAGTAATACCTGGGCG 5' 5' CGTGTCTCCTTCATTATGGACCCGA 3' | | |||||||||||||||||||| 3' GTAAAGAGGAAGTAATACCTGGGCG 5' 5' CGTGTCTTCTTCATTATGGACCAGC 3' | | ||| |||||||||||||| || 3' GTAAAGAGGAAGTAATACCTGGGCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:107791804..107791828 22/25 Antisense target st13.L
chr4S:88473392..88473416 21/25 Antisense target st13.S
chr6S:18844393..18844417 23/25 Sense off-target kiaa1217.S
chr1S:124614515..124614539 22/25 Sense off-target tmem233.S
chr3L:92354281..92354305 22/25 Antisense off-target tmod3.L
chr6S:88944122..88944146 22/25 Sense off-target garem1.S
chr1L:162186012..162186036 21/25 Antisense off-target hip1r.L
chr2L:179813748..179813772 21/25 Antisense off-target plekhb1.L
chr2L:6344875..6344899 21/25 Antisense off-target pou2f1.L
chr5S:82220483..82220507 21/25 Antisense off-target LOC108718034 [provisional:dvl3]
tropicalis 10.0 Chr4:115887070..115887094 25/25 Antisense target st13
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers