Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311481

Morpholino Name: suv39h2 MO1
Synonyms: Suv39h2, TEgg055l20, Xtsuv(3-9)2
Target mRNA: suv39h2

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCCATCTTGTACCGCCACTATTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GAATAGTGGCGGTACAAGATGGCTG 3' ||||||||||||||||||||||||| 3' CTTATCACCGCCATGTTCTACCGAC 5' 5' GACTAGCGGCGGTACAAGATGGCTG 3' || ||| |||||||||||||||||| 3' CTTATCACCGCCATGTTCTACCGAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:71830444..71830468 23/25 Antisense target suv39h2.L
chr3L:71830444..71830468 23/25 Sense off-target cdnf.L
tropicalis 10.0 Chr3:81272217..81272241 25/25 Antisense target suv39h2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers