Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311482

Morpholino Name: csrnp1 MO1
Synonyms: TIAP3, TNeu041f19, XtTAIP-2
Target mRNA: csrnp1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCGCTCATGGTTGCGCGTTTCATAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' CTATGAAACGCGCAACCATGAGCGG 3' ||||||||||||||||||||||||| 3' GATACTTTGCGCGTTGGTACTCGCC 5' 5' CTGTGAAACGCGTCACCATGAGCGG 3' || ||||||||| ||||||||||| 3' GATACTTTGCGCGTTGGTACTCGCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:7396782..7396806 22/25 Antisense target csrnp1.S
tropicalis 10.0 Chr6:13341010..13341034 25/25 Antisense target csrnp1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers