Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311484

Morpholino Name: tgif2 MO3
Synonyms: TNeu131c18, XtTALElike2
Target mRNA: tgif2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTCATCATTCTCCAATGCTCCCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAGGGAGCATTGGAGAATGATGAAT 3' ||||||||||||||||||||||||| 3' GTCCCTCGTAACCTCTTACTACTTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:42803874..42803898 22/25 Sense off-target trim33.S
chr7L:3431477..3431501 22/25 Antisense off-target atrnl1.L
Scaffold19:6009178..6009202 21/25 unknown
chr2S:149300..149324 21/25 unknown
tropicalis 10.0 Chr10:39618644..39618668 25/25 Antisense target tgif2
Chr1:38653975..38653999 21/25 Antisense off-target corin
Chr3:35803419..35803443 21/25 unknown
Chr6:35807404..35807428 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers