Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311485

Morpholino Name: tbx2 MO3
Synonyms: TNeu117j03, Xttbx2
Target mRNA: tbx2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGGAAAGCTGGATCTCTCATCGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ACCGATGAGAGATCCAGCTTTCCCG 3' ||||||||||||||||||||||||| 3' TGGCTACTCTCTAGGTCGAAAGGGC 5' 5' ACCGATGAGAGATCCAGCTTTCCCG 3' ||||||||||||||||||||||||| 3' TGGCTACTCTCTAGGTCGAAAGGGC 5' 5' ACCGATGAGAGATCCAGCTTTCCCG 3' ||||||||||||||||||||||||| 3' TGGCTACTCTCTAGGTCGAAAGGGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:90258698..90258722 25/25 Antisense target tbx2.L
chr2S:75681893..75681917 25/25 Antisense target tbx2.S
tropicalis 10.0 Chr2:92272975..92272999 25/25 Antisense target tbx2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers