Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311487

Morpholino Name: tbx3 MO1
Synonyms: TTpA012g23, Xttbx3
Target mRNA: tbx3

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGGATCTCTCATGGGTAAATTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' ATGAATTTACCCATGAGAGATCCAG 3' ||||||||||||||||||||||||| 3' TACTTAAATGGGTACTCTCTAGGTC 5' 5' ATGAATTTACCCATGAGAGATCCAG 3' ||||||||||||||||||||||||| 3' TACTTAAATGGGTACTCTCTAGGTC 5' 5' ATGAATTTACCCATGAGAGACCCAG 3' |||||||||||||||||||| |||| 3' TACTTAAATGGGTACTCTCTAGGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:144721848..144721872 25/25 Antisense target tbx3.L
chr1S:119199182..119199206 24/25 Antisense target tbx3.S
tropicalis 10.0 Chr1:145775740..145775764 25/25 Antisense target tbx3
Chr10:20185847..20185871 21/25 Antisense off-target cdh22
Chr5:34146584..34146608 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers