Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311489

Morpholino Name: tbx6 MO5
Synonyms: TGas124n10, XtTBX6
Target mRNA: tbx6

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTCAGTACATTGGGTGCAGGGACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGTCCCTGCACCCAATGTACTGAGC 3' ||||||||||||||||||||||||| 3' CCAGGGACGTGGGTTACATGACTCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:158937122..158937146 22/25 Sense off-target art5.S
chr2L:92930779..92930803 21/25 Sense off-target reps2.L
chr3L:75567668..75567692 22/25 unknown
tropicalis 10.0 Chr9:2433800..2433824 25/25 Antisense target tbx6
Chr8:60709636..60709660 22/25 Antisense off-target pcdh11x
Chr8:80872986..80873010 21/25 Sense off-target acp7
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers