Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311494

Morpholino Name: klf11 MO1
Synonyms: TEgg012b23, TIEG2, XtTIEG2Like
Target mRNA: klf11

Morpholino Type: uncategorized morpholino
Sequence: 5' ATACAGTCAGCATTGTGGGCTCTGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' TCAGAGCCCACAATGCTGACTGTAT 3' ||||||||||||||||||||||||| 3' AGTCTCGGGTGTTACGACTGACATA 5' 5' ACAGAGCCCACAATGCTGACTGTGT 3' |||||||||||||||||||||| | 3' AGTCTCGGGTGTTACGACTGACATA 5' 5' GCAGAGCCCACAATGCTGACTGTGT 3' |||||||||||||||||||||| | 3' AGTCTCGGGTGTTACGACTGACATA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:137968709..137968733 23/25 Antisense target klf11.L
chr5S:118996532..118996556 23/25 Antisense target klf11.S
chr5L:38256049..38256073 21/25 Sense off-target LOC108716110 [provisional:slc24a3]
tropicalis 10.0 Chr5:138140539..138140563 25/25 Antisense target klf11
Chr8:25359498..25359522 21/25 Antisense off-target wnk3
Chr1:176393838..176393862 22/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers