Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311495

Morpholino Name: nsa2 MO1
Synonyms: TGas064l01, Tinp1, XtTINP1
Target mRNA: nsa2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTCGATGTAGTCGTTCTGAGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 22/25 22/25
genomic

MO
5' CAGCCTCAGAACGACTACATCGAAT 3' ||||||||||||||||||||||| 3' TACGGAGTCTTGCTGATGTAGCTTA 5' 5' CAGCCGCAGAACGACTACATCGAAT 3' ||| ||||||||||||||||||| 3' TACGGAGTCTTGCTGATGTAGCTTA 5' 5' CAGCCGCAGAACGACTACATCGAAT 3' ||| ||||||||||||||||||| 3' TACGGAGTCTTGCTGATGTAGCTTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:187283547..187283571 22/25 Antisense target nsa2.L
chr1S:156229509..156229533 22/25 Antisense target nsa2.S
tropicalis 10.0 Chr1:184045595..184045619 23/25 Antisense target nsa2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers