Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311496

Morpholino Name: tsg101 MO1
Synonyms: TGas010f07, Xttsp101
Target mRNA: tsg101

Morpholino Type: uncategorized morpholino
Sequence: 5' TGAGCTGGGCCTCAGACAGCGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGCGCTGTCTGAGGCCCAGCTCA 3' ||||||||||||||||||||||||| 3' TACCGCGACAGACTCCGGGTCGAGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:17981740..17981764 22/25 unknown
tropicalis 10.0 Chr4:530303..530327 25/25 Antisense target tsg101
Chr4:530303..530327 25/25 Sense off-target Xetrov107027714m.g
Chr4:32163674..32163698 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers