Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311497

Morpholino Name: vegt MO9
Synonyms: TEgg048b09, XtVegT1
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCTCCATATAAAAACTCTGCTGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' TGCAGCAGAGTTTTTATATGGAGCG 3' ||||||||||||||||||||||||| 3' ACGTCGTCTCAAAAATATACCTCGC 5' 5' TGCAGCAGAGTTTTTATATTGAGCA 3' ||||||||||||||||||| |||| 3' ACGTCGTCTCAAAAATATACCTCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:152598864..152598888 23/25 Antisense target vegt.L
chr4L:48390386..48390410 22/25 Antisense off-target bean1.L
chr9_10L:60267599..60267623 21/25 Antisense off-target pkp4.L
chr5S:124948476..124948500 21/25 unknown
chr7L:26260348..26260372 21/25 unknown
tropicalis 10.0 Chr1:152863141..152863165 25/25 Antisense target vegt
Chr4:37714628..37714652 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers