Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311498

Morpholino Name: vegt MO10
Synonyms: TEgg048b09, XtVegT1.2
Target mRNA: vegt

Morpholino Type: translation blocking morpholino
Sequence: 5' TGTGTTCCTGACAGCAGTTTCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25 21/25
genomic

MO
5' ATGAGAAACTGCTGTCAGGAACACA 3' ||||||||||||||||||||||||| 3' TACTCTTTGACGACAGTCCTTGTGT 5' 5' ATGAGAAACTGCTGTCGGGAATGCG 3' |||||||||||||||| |||| | 3' TACTCTTTGACGACAGTCCTTGTGT 5' 5' ATGAGAAACTGCTGTCGGGAACGTG 3' |||||||||||||||| ||||| 3' TACTCTTTGACGACAGTCCTTGTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:152598793..152598817 21/25 Antisense target vegt.L
chr1S:126245220..126245244 21/25 Antisense target vegt.S
chr9_10L:87615623..87615647 21/25 Antisense off-target LOC108701515 [provisional:gm29884]
Scaffold1473:227..251 21/25 unknown
chr8S:6297391..6297415 21/25 unknown
tropicalis 10.0 Chr1:152863070..152863094 25/25 Antisense target vegt
Chr3:125527891..125527915 21/25 Antisense off-target polm
Chr3:125527891..125527915 21/25 Sense off-target h2az2
Chr8:51640943..51640967 21/25 Antisense off-target dcx
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers