Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311499

Morpholino Name: wnt11b MO5
Synonyms: TGas144p20, Xtwnt11
Target mRNA: wnt11b

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGATCTGAGCCATTGCTAGTGCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:88577430..88577454 22/25 Sense off-target tmbim4.S
Scaffold88407:91..115 22/25 unknown
tropicalis 10.0 Chr8:43791908..43791932 25/25 Antisense off-target LOC493495
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers