Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311500

Morpholino Name: wnt11b MO6
Synonyms: TGas144p20, Xtwnt11.2
Target mRNA: wnt11b

Morpholino Type: uncategorized morpholino
Sequence: 5' TGACACAGTGATGGATCTGAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' ATGGCTCTAATCCGTCACTGTGTCA 3' ||||||| |||| ||||||||||| 3' TACCGAGTCTAGGTAGTGACACAGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:117285831..117285855 22/25 Antisense off-target pcdhga3.S
chr3S:117285831..117285855 22/25 Antisense off-target LOC108713301 [provisional:pcdhgc5]
chr8L:19507360..19507384 21/25 Antisense off-target LOC108698306
tropicalis 10.0 Chr8:43798346..43798370 22/25 Antisense target wnt11b
Chr8:43791897..43791921 25/25 Antisense off-target LOC493495
Chr8:85187141..85187165 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers