Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311501

Morpholino Name: wnt5b MO1
Synonyms: TGas012b13, Xtwnt5c
Target mRNA: wnt5b

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGTAGTCGCAGAATTCCCGTCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25 21/25
genomic

MO
5' CATGACGGGAATTCTGCGACTACTG 3' ||||||||||||||||||||||||| 3' GTACTGCCCTTAAGACGCTGATGAC 5' 5' CATGACGCCAATTCTGCGACTTCTC 3' ||||||| |||||||||||| || 3' GTACTGCCCTTAAGACGCTGATGAC 5' 5' CATGACGCCAATTCTGCGACTTCTC 3' ||||||| |||||||||||| || 3' GTACTGCCCTTAAGACGCTGATGAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold39:1197561..1197585 21/25 Antisense target wnt5b.L
chr3S:5757050..5757074 21/25 Antisense target wnt5b.S
tropicalis 10.0 Chr3:9386048..9386072 25/25 Antisense target wnt5b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers