Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311502

Morpholino Name: wnt5b MO2
Synonyms: TGas012b13, Xtwnt5c.2
Target mRNA: wnt5b

Morpholino Type: uncategorized morpholino
Sequence: 5' AATTCCCGTCATGCTGCTCCTCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 22/25
genomic

MO
5' GGAGAGGAGCAGCATGACGGGAATT 3' ||||||||||||||||||||||||| 3' CCTCTCCTCGTCGTACTGCCCTTAA 5' 5' GGAGAGGAGCAGCATGACGCCAATT 3' ||||||||||||||||||| |||| 3' CCTCTCCTCGTCGTACTGCCCTTAA 5' 5' GGAGAGGAGCAACATGACGCCAATT 3' ||||||||||| ||||||| |||| 3' CCTCTCCTCGTCGTACTGCCCTTAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold39:1197549..1197573 23/25 Antisense target wnt5b.L
chr3S:5757062..5757086 22/25 Antisense target wnt5b.S
chr1L:204169238..204169262 21/25 Antisense off-target adamts12.L
chr1S:163963597..163963621 21/25 Sense off-target nudt2.S
chr3S:32277909..32277933 21/25 Antisense off-target unc5d.S
chr6L:107105480..107105504 21/25 Antisense off-target LOC108718549 [provisional:mettl4]
chr6S:55321577..55321601 21/25 Antisense off-target Xelaev18033320m
chr7L:55010883..55010907 21/25 Sense off-target kdm2a.L
chr7L:55010883..55010907 21/25 Antisense off-target Xelaev18035112m
chr7L:66651518..66651542 21/25 Sense off-target arhgap32.L
chr4L:109171965..109171989 22/25 unknown
chr1S:50710236..50710260 21/25 unknown
chr2L:60513983..60514007 21/25 unknown
chr5L:82617816..82617840 21/25 unknown
chr5S:121647862..121647886 21/25 unknown
chr5S:38486012..38486036 21/25 unknown
chr8L:37762834..37762858 21/25 unknown
chr8S:62135861..62135885 21/25 unknown
tropicalis 10.0 Chr3:9386060..9386084 25/25 Antisense target wnt5b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers