Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311503

Morpholino Name: wnt8a MO5
Synonyms: TNeu118d19, Xtwnt8
Target mRNA: wnt8a

Morpholino Type: uncategorized morpholino
Sequence: 5' GGAGACTGCTATCCAGGGTAATGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGCATTACCCTGGATAGCAGTCTCC 3' ||||||||||||||||||||||||| 3' TCGTAATGGGACCTATCGTCAGAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr3:31431182..31431206 25/25 Antisense target wnt8a
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers